Selection of Patients


From 40 patients specimens were obtained from patients treated with radical prostatectomy (RP). From over 300 patients two groups were selected which had prostate tumors with either well differentiated (WD) or poorly differentiated (PD) after radical RP. The PD group had Gleason score 8-9, seminal vesicle invasion, and poorly differentiated tumor cells; the WD group had Gleason score 6-7, no seminal vesicle invasion, and well to moderately differentiated tumor cells. LCM compatible specimens were selected from age and race (Caucasians) matched PD or WD patients with no family history of CaP.
Note: yearly PSA screening is mandatory for military health care recipients.

Tissue Samples and Laser-Capture Microdissection and RNA amplification

Normal and cancer cells were laser capture microdissected (LCM) (Arcturus Pixel 2) by AFIP pathologists from OCT embedded and H&E stained frozen prostate sections of radical prostatectomy specimens (2000 laser shots for one sample). Total RNA was isolated from the LCM samples with the MicroRNA kit (Stratagene, La Jolla, CA), quantified using RiboGreen dye (Molecular Probes, Eugene, OR) and VersaFluor fluorimeter (BioRad, Hercules, CA), and quality tested by quantitative RT-PCR using NKX3.1 and GAPDH primers. Linear RNA amplification was performed using RiboAmp RNA amplification kit (Arcturus, Mountain View, CA). Precisely, 2 nanograms of total RNA from LCM derived epithelial cells of normal as well as tumor tissue from each patient was used for the first round of amplification. During the second round of amplification after cDNA synthesis and purification the samples were biotinylated during in vitro transcription which was used for the GeneChip analysis.

20 patients with well differentiated tumor(s) (WD). Patient numbers 1-20.
Laser capture microdissection was performed to isolate WD tumor cells (Tumors WD) and to isolate epithelial cells with normal (benign) morphology (Normal from prostate with WD) from the same prostate.

20 patients with poorly differentiated tumor(s) (PD). Patient numbers 21-40.
Laser capture microdissection was performed to isolate PD tumor cells (Tumors PD) and to isolate epithelial cells with normal (benign) morphology (Normal from prostate with PD) from the same prostate.

Gene Chip Processing and Analysis

Linearly amplified aRNA was used to hybridize to high-density oligonucleotide human genome array HG U133A array (Affymetrix, Santa Clara, CA, USA) that contains 22,283 probe sets which represents about 18,000 well annotated genes and the rest represents expressed sequence tags (EST) and hypothetical genes. Biotinylation was carried out using aRNA by In vitro transcription using MEGA script T7 in vitro Transcription Kit (Ambion, Austin, TX, USA) cDNA and biotinylated UTP and biotinylated CTP (ENZO, Farmingdale, NY, USA)(34). The biotin labeled cRNA was purified using the QIAGEN RNeasy spin columns (QIAGEN, Valencia, CA) following the manufacturer's protocol. The biotin labeled cRNA was fragmented in a 40 µl reaction mixture containing 40 mM Tris-acetate, pH 8.1, 100 mM potassium acetate, and 30 mM magnesium acetate incubated at 94°C for 35 minutes and then put on ice. The biotin labeled and fragmented aRNA was hybridized to the HG U133A human genechip array (Affymetrix, Santa Clara, CA). Briefly, a 220 µl hybridization solution consisting of: 1M NaCl, 10 mM Tris pH 7.6, 0.005% Triton X-100, 50 pM control Oligo B2 (5' bioGTCAAGATGCTACCGTTCAG 3') (Affymetrix); the control cRNA cocktail of: Bio B (150 pM), Bio C (500 pM), Bio D (2.5 nM) and Cre X (10 nM) (American Type Tissue Collection, Manassas,VA and Lofstrand Labs, Gaithersburg, MD), 0.1 mg/ml herring sperm DNA and 0.05 µg/µl of the fragmented labeled sample cRNA was heated to 95°C for 35 min., cooled to 40°C and clarified by centrifugation. Hybridization was at 42°C in a rotisserie hybridization oven (Model 320, Affymetrix) at 60 rpm for 16 hours. Following hybridization, the GeneChip arrays were washed 10 times at 25°C with 6X SSPE-T buffer (1 M NaCl, 0.006 M EDTA, and 0.06 M Na3PO4 , 0.005% Triton X-100, pH 7.6) using the automated fluidics station protocol. GeneChip arrays were incubated at 50°C in 0.5X SSPE-T, 0.005% Triton X-100 for 20 minutes at 60 rpm in the rotisserie oven. GeneChip arrays were stained for 15 minutes at room temperature and at 60 rpm, with streptavidin phycoerythrin (Molecular Probes, Inc., Eugene, OR) stain solution at a final concentration of 10 µg/ml in 6X SSPE-T buffer and 1.0 mg/ml acetylated bovine serum albumin (Sigma). GeneChip arrays were washed twice at room temperature with 6X SSPE-T buffer. GeneChip arrays were scanned with the HP GeneArray Scanner (Hewlett-Packard, Santa Clara, CA) controlled by GeneChip 3.1 Software (Affymetrix).

Image Analysis and Data Collection

Affymetrix GeneChip Microarray Analysis Software, version 3.1 and Affymetrix Micro DB and Data Mining Tool version 2.0 (Affymetrix), Microsoft Excel 2000 (Microsoft, Seattle, WA) and Statistica version 4.1 (Stat Soft, Inc., Tulsa, OK) were used. In the Affymetrix system, the average difference fluorescence is the average of the difference between every perfect match probe cell and its control mismatch probe cell and is directly related to the level of expression of a transcript. A comparative file indicates the relative change in abundance (fold change) for each transcript between a baseline and an experimental sample.

Thus, 80 base-line normalized microarray datasets are provided in txt file format:
Note:
Convert txt files to MS Excel format by opening the txt document from within the Excel application.

Tumor WD from patients #1-20 | matching Normal from WD patients #1-20) = 40 genechip
Tumor PD from patients #21-40 | matching Normal from PD patients #21-40) = 40 genechip